English Cymraeg
Inter-laboratory collaborative trial of real-time PCR method phase 2

Inter-laboratory collaborative trial of real-time PCR method phase 2: Appendix 2 Collaborative trial raw data

Practical instructions on the collaborative trail MA0201.

Diweddarwyd ddiwethaf: 5 April 2023
Gweld as PDF
Diweddarwyd ddiwethaf: 5 April 2023
Gweld as PDF

Collaborative trial MA0201 practical instructions Appendix 1

Table A1: Sequence of the primers and probe for each of the horse, pork and mammalian (myostatin) assays used in the collaborative trial. 

Target Assay ref Sequence (5'-3') Labelling
Horse
(Köppel, R. et al. 2011)		 Forward CCAACTTCATCATGGACAACGC -
Horse
(Köppel, R. et al. 2011)		 Reverse  GTTAAAGCTTGGCTCGACACG -
Horse
(Köppel, R. et al. 2011)		 Probe  AAGTGCATCCCCGTGGCCCCTCA 6 FAM NFQ
Pork
(Köppel, R. et al. 2011)		 Forward GGAGTGTGTATCCCGTAGGTG -
Pork
(Köppel, R. et al. 2011)		 Reverse  CTGGGGACATGCAGAGAGTG -
Pork
(Köppel, R. et al. 2011)		 Probe TCTGACGTGACTCCCCGACCTGG 6 FAM NFQ
Mammalian Myostatin
(Laube, I. et al. 2013)		 Forward TCTGACGTGACTCCCCGACCTGG -
Mammalian Myostatin
(Laube, I. et al. 2013)		 Reverse  ATACCAGTGCCTGGGTTCAT -
Mammalian Myostatin
(Laube, I. et al. 2013)		 Probe CCCATGAAAGACGGTACAAGGTATACTG 6 FAM NFQ

Köppel, R., Ruf, J., Rentsch, J. Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, horse and sheep. Eur Food Res Technol. 2011;232(1):151-5. 10.1007/s00217-010-1371-y

Laube, I., Spiegelberg, A., Butschke, A., Zagon, J., Schauzu, M., Kroh, L., et al. Methods for the detection of beef and pork in foods using real-time polymerase chain reaction. International Journal Of Food Science & Technology. 2003;38(2):111-8. 10.1046/j.1365-2621.2003.00651.x.

Collaborative trial MA0201 practical instructions Appendix 2

Suggested plate plans for the horse assay and the mammalian myostatin assay.

Plate 1 Horse

Letter 1 2 3 4 5 6 7 8 9 10 11 12 Note
A Std 1/H Std 1/H Std 1/H Std 2/H Std 2/H Std 2/H Std 3/H Std 3/H Std 3/H Std 4/H Std 4/H Std 4/H Horse assay
B Std 5/H Std 5/H Std 5/H NTC NTC NTC 1 1 1 2 2 2 -
C 3 3 3 4 4 4 5 5 5 6 6 6 -
D 7 7 7 8 8 8 9 9 9 10 10 10 -
E Std 1/H Std 1/H Std 1/H Std 2/H Std 2/H Std 2/H Std 3/H Std 3/H Std 3/H Std 4/H Std 4/H Std 4/H Myostatin
F Std 5/H Std 5/H Std 5/H NTC NTC NTC 1 1 1 2 2 2 -
G 3 3 3 4 4 4 5 5 5 6 6 6 -
H 7 7 7 8 8 8 9 9 9 10 10 10 -

Plate 2 Horse

Letter 1 2 3 4 5 6 7 8 9 10 11 12 Note
A Std 1/H Std 1/H Std 1/H Std 2/H Std 2/H Std 2/H Std 3/H Std 3/H Std 3/H Std 4/H Std 4/H Std 4/H Horse assay
B Std 5/H Std 5/H Std 5/H NTC NTC NTC 11 11 11 12 12 12 -
C 13 13 13 14 14 14 15 15 15 16 16 16 -
D 17 17 17 18 18 18 19 19 19 20 20 20 -
E Std 1/H Std 1/H Std 1/H Std 2/H Std 2/H Std 2/H Std 3/H Std 3/H Std 3/H Std 4/H Std 4/H Std 4/H Myostatin
F Std 5/H Std 5/H Std 5/H NTC NTC NTC 11 11 11 12 12 12 -
G 13 13 13 14 14 14 15 15 15 16 16 16 -
H 17 17 17 18 18 18 19 19 19 20 20 20 -

Plate 3 Horse

Letter 1 2 3 4 5 6 7 8 9 10 11 12 Note
A Std 1/H Std 1/H Std 1/H Std 2/H Std 2/H Std 2/H Std 3/H Std 3/H Std 3/H Std 4/H Std 4/H Std 4/H Horse assay
B Std 5/H Std 5/H Std 5/H NTC NTC NTC 21 21 21 22 22 22 -
C 23 23 23 24 24 24 25 25 25 26 26 26 -
D 27 27 27 28 28 28 29 29 29 30 30 30 -
E Std 1/H Std 1/H Std 1/H Std 2/H Std 2/H Std 2/H Std 3/H Std 3/H Std 3/H Std 4/H Std 4/H Std 4/H Myostatin
F Std 5/H Std 5/H Std 5/H NTC NTC NTC 21 21 21 22 22 22 -
G 23 23 23 24 24 24 25 25 25 26 26 26 -
H 27 27 27 28 28 28 29 29 29 30 30 30 -

Suggested plate plans for the pork assay and the mammalian myostatin assay

Plate 1 Pork

Letter 1 2 3 4 5 6 7 8 9 10 11 12 Note
A Std 1/P Std 1/P Std 1/P Std 2/P Std 2/P Std 2/P Std 3/P Std 3/P Std 3/P Std 4/P Std 4/P Std 4/P Pork assay
B Std 5/P Std 5/P Std 5/P NTC NTC NTC 1 1 1 2 2 2 -
C 3 3 3 4 4 4 5 5 5 6 6 6 -
D 7 7 7 8 8 8 9 9 9 10 10 10 -
E Std 1/P Std 1/P Std 1/P Std 2/P Std 2/P Std 2/P Std 3/P Std 3/P Std 3/P Std 4/P Std 4/P Std 4/P Myostatin
F Std 5/P Std 5/P Std 5/P NTC NTC NTC 1 1 1 2 2 2 -
G 3 3 3 4 4 4 5 5 5 6 6 6 -
H 7 7 7 8 8 8 9 9 9 10 10 10 -

Plate 2 Pork

Letter 1 2 3 4 5 6 7 8 9 10 11 12 Note
A Std 1/P Std 1/P Std 1/P Std 2/P Std 2/P Std 2/P Std 3/P Std 3/P Std 3/P Std 4/P Std 4/P Std 4/P Pork assay
B Std 5/P Std 5/P Std 5/P NTC NTC NTC 11 11 11 12 12 12 -
C 13 13 13 14 14 14 15 15 15 16 16 16 -
D 17 17 17 18 18 18 19 19 19 20 20 20 -
E Std 1/P Std 1/P Std 1/P Std 2/P Std 2/P Std 2/P Std 3/P Std 3/P Std 3/P Std 4/P Std 4/P Std 4/P Myostatin
F Std 5/P Std 5/P Std 5/P NTC NTC NTC 11 11 11 12 12 12 -
G 13 13 13 14 14 14 15 15 15 16 16 16 -
H 17 17 17 18 18 18 19 19 19 20 20 20 -

Plate 3 Pork

Letter 1 2 3 4 5 6 7 8 9 10 11 12 Note
A Std 1/P Std 1/P Std 1/P Std 2/P Std 2/P Std 2/P Std 3/P Std 3/P Std 3/P Std 4/P Std 4/P Std 4/P Pork assay
B Std 5/P Std 5/P Std 5/P NTC NTC NTC 21 21 21 22 22 22 -
C 23 23 23 24 24 24 25 25 25 26 26 26 -
D 27 27 27 28 28 28 29 29 29 30 30 30 -
E Std 1/P Std 1/P Std 1/P Std 2/P Std 2/P Std 2/P Std 3/P Std 3/P Std 3/P Std 4/P Std 4/P Std 4/P Myostatin
F Std 5/P Std 5/P Std 5/P NTC NTC NTC 21 21 21 22 22 22 -
G 23 23 23 24 24 24 25 25 25 26 26 26 `
H 27 27 27 28 28 28 29 29 29 30 30 30 -

Appendix 2: Collaborative trial raw data 

Horse in processed beef

Nominal level (%) 0.1 0.1 0.5 0.5 1 1 3 3 10 10
Sample ID PCR_17 PCR_18 PCR_09 PCR_12 PCR_06 PCR_02 PCR086 PCR_05 PCR_19 PCR_26
Lab no.1  0.26 0.2 1.04 0.83 2.34 2.58 4.55 5.11 c 13.44 10.65
Lab no.2 0.23 0.25 1.17 1.15 2.2 2.22 3.92 3.9 12.83 10.15
Lab no.3 0.19 0.17 1.01 0.8 2.05 1.85 3.72 3.47 10.96 11.26
Lab no.4 0.24 0.33 0.89 1.04 1.76 1.81 3.65 3.67 13.18 11.63
Lab no.5  0.15 0.18 0.74 0.79 1.62 1.57 3.07 3.19 11.18 10.26
Lab no.6  0.16 0.16 0.9 0.81 1.76 1.72 3.5 3.55 10.06 9.74
Lab no.7 0.13 0.16 0.8 0.68 1.63 1.47 3.2 3.35 9.57 10.98
Lab no.8 0.16 0.18 0.72 0.88 1.59 1.4 3.05 2.99 9.16 10.73
Lab no.9 0.14 0.12 0.77 0.78 1.52 1.61 2.84 3.1 9.18 10.62
Lab no.10 0.1 0.1 0.5 0.5 1 1 3 3 10 10
Lab no.11 0.1 0.18 0.87 0.77 1.83 1.9 3.47 3.42 10.95 10.12
Lab no.12 0.17 0.23 1.66 c 1.14 c 3.38 g 3.5 g 5.45 g 5.29 g 9.98 12.08
Lab no.13 0.09 0.14 ND 0.69 1.67 1.85 3.47 3.02 8.99 9.08
Lab no.14 0.1 0.13 0.62 0.68 1.17 1.58 2.42 3.12 9.08 7.94
Lab no.15 0.21 0.3 0.98 ND 1.86 1.73 5.07 c 3.86 c 18.68 g 20 g

Pork in processed beef

Nominal level (%) 0.1 0.1 0.5 0.5 1 1 3 3 10 10
Sample ID PCR_13 PCR_14 PCR_03 PCR_11 PCR_07 PCR_21 PCR_25 PCR_22 PCR_20 PCR_24
Lab no.1  0.11 0.09 0.6 0.6 1.28 1.66 3.31 2.78 5.85 7.48
Lab no.2 0.18 0.13 0.84 0.76 1.74 1.58 2.67 2.6 7.28 7.04
Lab no.3 0.18 0.17 0.57 0.64 1.21 1.14 2.85 c 1.86 c 9.24 7.42
Lab no.4 0.19 0.22 0.72 0.88 1.89 1.49 2.37 2.42 9.16 6.82
Lab no.5  0.09 0.12 0.5 0.45 1.36 1.37 2.41 2.34 7.63 7.24
Lab no.6  0.1 0.11 0.58 0.55 1.19 1.57 2.16 2.45 6.58 6.56
Lab no.7 0.09 0.16 0.63 0.61 1.3 1.36 2.29 1.99 8 5.8
Lab no.8 0.19 0.2 0.71 0.7 1.36 1.42 2.54 2.55 7.24 7.29
Lab no.9 0.18 0.15 0.61 0.75 1.31 1.47 2.69 2.41

6.62

 6.78
Lab no.10 0.1 0.1 0.5 0.5 0.5 1 3 3 10 10
Lab no.11 0.13 0.17 0.6 0.77 1.33 1.56 2.48 2.52 6.82 7.09
Lab no.12 0.44 g 0.48 g 1.38 g 1.55 g 2.7 g 3.89 g 7.39 g 5.38 g 12.14 g 12.49 g
Lab no.13 0.11 0.1 0.54 0.42 1 1.3 2.17 2.33 6.41 6.13
Lab no.14 0.09 0.07 0.41 0.53 0.93 0.9 1.3 1.64 6.19 5.23
Lab no.15 0.1 0.09 0.74 0.56 2.62 1.9 6.26 c 2.24 c 8.94 9.07

Pork in raw beef

Nominal level (%) 0.1 0.1 0.5 0.5 1 1 3 3 10 10
Sample ID PCR_23 PCR_28 PCR_30 PCR_04 PCR_27 PCR_01 PCR_16 PCR_10 PCR_29 PCR_15
Lab no.1  0.13 0.12 0.57 0.48 1.59 1.26 3.17 3.08 10.72 9.02
Lab no.2 0.18 0.14 0.74 0.87 1.59 1.75 3.53 3.94 10.94 10.28
Lab no.3 0.07 0.05 0.63 0.43 1.63 0.99 3.83 2.69 10.58 11.67
Lab no.4 0.07 0.16 0.64 0.82 1.22 1.72 4.27 4.67 10.94 11.68
Lab no.5  0.13 0.1 0.64 0.42 1.29 1.09 2.78 3.06 10.74 9.62
Lab no.6  0.12 0.08 0.57 0.55 1.18 1.03 2.91 2.78 9.86 9.36
Lab no.7 0.07 0.11 0.59 0.62 0.99 1.48 3.88 c 1.89 c 8.52 11.52
Lab no.8 0.14 0.13 0.74 0.55 1.37 1.42 3.49 3.5 10.49 10.74
Lab no.9 0.18 0.13 0.61 0.57 1.32 1.15 3.34 3.04 10.48 10.49
Lab no.10 0.1 0.1 1 0.5 1 1 3 3 10 10
Lab no.11 0.1 0.12 0.65 0.57 1.19 1.18 3.31 3.37 10.09 9.69
Lab no.12 0.66 g 0.48 g 1.77 g 1.29 g 3.08 g 2.77  6.15 g 4.83 g  16.3 g 16.42 g
Lab no.13 0.08 0.09 0.49 0.5 1.1 1.11 2.56 2.63 9.6 7.76
Lab no.14 0.03 0.05 0.33 0.51 0.58 1.01 2.57 2.57 6.12 g 7.39 g
Lab no.15 0.09 0.08 0.88 0.85 1.83 1.26 3.35 c 7.83 c 40.18 c 11.3 c

Calibration performance reported by laboratories

Lab number Pork 1 Pork 2 Pork 3 Horse 1 Horse 2 Horse 3
1 0.999 0.999 0.994 0.998 0.997 0.999
2 0.993 0.995 0.994 0.996 0.997 0.998
3 0.997 0.985 0.998 0.994 0.996 0.994
4 0.994 0.996 0.997 0.990 0.997 0.999
5 0.998 0.998 0.999 0.992 0.998 0.995
6 0.998 0.998 0.995 0.998 0998 0.992
7 0.998 0.997 0.998 0.999 0.996 0.999
8 0.996 0.997 0.999 0.995 0.991 0.998
9 0.999 0.999 0.999 0.995 0.993 0.953#
10 0.991 0.993 0.997 0.990 0.996 0.994
11 0.999 0.998 0.998 0.999 0.998 0.991
12 0.996 0.999 0.997 0.999 1.00 0.995
13 0.999 0.995 0.999 0.995 0.993 0.998
14 0.998 0.999 0.995 0.977# 0.996 0.988
15 0.991 0.997 0.963# 0.977# 0.958# 0.993

Acceptance criterion _>0.98, # indicates <0.98. Assay plate number indicated by 1, 2 or 3 following the target matrix of pork or horse.

PCR efficiency reported by laboratories (PCR efficiency %)

Lab number Pork 1 Pork 2 Pork 3 Horse 1 Horse 2 Horse 3
1 96.6 92.5 91.5 101 103 96.4
2 83.2# 89.3 84.9# 87.7 86.6 88.9
3 99.1 91.0 97.2 89.7 94.5 87.6
4 91.6 88.4 94.7 95.0 85.4 88.1
5 98.5 100 93.3 97.0 93.0 95.2
6 100 98.8 93.2 91.6 96.8 91.3
7 90.2 91.6 96.2 94.6 94.4 96.9
8 95.8 100 93.3 97.0 93.0 95.2
9 94.8 89.8 90.6 93.7 93.7 98.3
10 94.8 90.5 90.7 104 93.3 89.8
11 93.8 95.6 90.9 94.2 97.3 91.0
12 80.5# 79.5# 71.8# 72.1# 82.8# 89.1
13 95.6 98.9 96.1 92.9 102 98.0
14 95.4 99.1 104 92.4 95.9 88.8
15 106 105 105 104 109 108

Acceptance criterion 85 to 115%, # indicates value outside acceptance criterion. Assay plate number indicated by 1, 2 or 3 following the target matrix of pork or horse. 

Yn ôl i’r brig
Yn ôl i’r brig